Review



mouse primer sequences  (Eurofins)

 
  • Logo
  • About
  • News
  • Press Release
  • Team
  • Advisors
  • Partners
  • Contact
  • Bioz Stars
  • Bioz vStars
    • 86
      Buy from Supplier

    Structured Review

    Eurofins mouse primer sequences
    Mouse Primer Sequences, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+primer+sequences/primer+sequences/bio_rxiv__2025__09__13__676049-85-1-19
    Average 86 stars, based on 1 article reviews
    mouse primer sequences - by Bioz Stars, 2026-10
    86/100 stars

    Images

    Related Articles

    other:

    Article Title: Young adult microglial deletion of C1q reduces engulfment of synapses and prevents cognitive impairment in an aggressive Alzheimer’s disease mouse model
    Article Snippet: The mouse primer sequences for C3, C4 , C5ar1 and Hprt were obtained from their corresponding reference obtained from Eurofins (Fisher Scientific) ( ) . cDNA from each hippocampus was tested in triplicate.

    Article Title: Targeting epidermal growth factor to treat vascular calcification
    Article Snippet: The following mouse primer sequences were purchased from Eurofins Scientific; Gapdh Forward: AACGACCCCTTCATTGAC (SEQ ID NO: 9) and Reverse: TCCACGACATACTCAGCAC (SEQ ID NO: 10); Colla1 Forward: CCTCAGGGTATTGCTGGACAAC (SEQ ID NO: 11) and Reverse: ACCACTTGATCCAGAAGGACCTT (SEQ ID NO: 12); Tgfb1 Forward: TGGAGCAACATGTGGAACTC (SEQ ID NO: 13) and Reverse: CAGCAGCCGGTTACCAAG (SEQ ID NO: 14).



    Similar Products

    primer and taqman probe sequences mouse il6  (Thermo Fisher)
    90
    Thermo Fisher primer and taqman probe sequences mouse il6
    Primer And Taqman Probe Sequences Mouse Il6, supplied by Thermo Fisher, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+primer+sequences/primer+and+taqman+probe+sequences+mouse+il6/pmc09257242__Table_1-1-0-7
    Average 90 stars, based on 1 article reviews
    primer and taqman probe sequences mouse il6 - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    mouse primer sequences  (MedChemExpress)
    94
    MedChemExpress mouse primer sequences
    Mouse Primer Sequences, supplied by MedChemExpress, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+primer+sequences/GW280264X/pm42021473-131-13-26
    Average 94 stars, based on 1 article reviews
    mouse primer sequences - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    sequence information  (OriGene)
    94
    OriGene sequence information
    Sequence Information, supplied by OriGene, used in various techniques. Bioz Stars score: 94/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+primer+sequences/Clu+Mouse+qPCR+Primer+Pair/pm41865465-59-10-15
    Average 94 stars, based on 1 article reviews
    sequence information - by Bioz Stars, 2026-10
    94/100 stars
    		  Buy from Supplier
    sequence  (OriGene)
    93
    OriGene sequence
    Sequence, supplied by OriGene, used in various techniques. Bioz Stars score: 93/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+primer+sequences/H2az1+Mouse+qPCR+Primer+Pair/pmc12484829__41467_2025_64195_MOESM1_ESM-110-6-20
    Average 93 stars, based on 1 article reviews
    sequence - by Bioz Stars, 2026-10
    93/100 stars
    		  Buy from Supplier
    mouse primer sequences  (Eurofins)
    86
    Eurofins mouse primer sequences
    Mouse Primer Sequences, supplied by Eurofins, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+primer+sequences/primer+sequences/bio_rxiv__2025__09__13__676049-85-1-19
    Average 86 stars, based on 1 article reviews
    mouse primer sequences - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    mouse pcr primer sequences  (Sangon Biotech)
    86
    Sangon Biotech mouse pcr primer sequences
    Mouse Pcr Primer Sequences, supplied by Sangon Biotech, used in various techniques. Bioz Stars score: 86/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+primer+sequences/primer+sequences/pm40846098-103-1-10
    Average 86 stars, based on 1 article reviews
    mouse pcr primer sequences - by Bioz Stars, 2026-10
    86/100 stars
    		  Buy from Supplier
    mouse gapdh primer (forward sequence: catcactgccacccagaagactg)  (Bioneer Corporation)
    90
    Bioneer Corporation mouse gapdh primer (forward sequence: catcactgccacccagaagactg)
    Mouse Gapdh Primer (Forward Sequence: Catcactgccacccagaagactg), supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+primer+sequences/mouse+gapdh+primer++reverse+sequence++atgccagtgagcttcccgttcag+/pm39799744-57-34-49
    Average 90 stars, based on 1 article reviews
    mouse gapdh primer (forward sequence: catcactgccacccagaagactg) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    mouse gapdh primer (reverse sequence: atgccagtgagcttcccgttcag)  (Bioneer Corporation)
    90
    Bioneer Corporation mouse gapdh primer (reverse sequence: atgccagtgagcttcccgttcag)
    Mouse Gapdh Primer (Reverse Sequence: Atgccagtgagcttcccgttcag), supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+primer+sequences/mouse+gapdh+primer++reverse+sequence++atgccagtgagcttcccgttcag+/pm39799744-57-41-49
    Average 90 stars, based on 1 article reviews
    mouse gapdh primer (reverse sequence: atgccagtgagcttcccgttcag) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    mouse il-6 primer (reverse sequence: ctgcaagtgcatcatcgttgttc)  (Bioneer Corporation)
    90
    Bioneer Corporation mouse il-6 primer (reverse sequence: ctgcaagtgcatcatcgttgttc)
    Mouse Il 6 Primer (Reverse Sequence: Ctgcaagtgcatcatcgttgttc), supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+primer+sequences/oligonucleotide+primers/pm39799744-57-28-49
    Average 90 stars, based on 1 article reviews
    mouse il-6 primer (reverse sequence: ctgcaagtgcatcatcgttgttc) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier
    mouse il-12b primer (reverse sequence: ccacctgtgagttcttcaaaggc)  (Bioneer Corporation)
    90
    Bioneer Corporation mouse il-12b primer (reverse sequence: ccacctgtgagttcttcaaaggc)
    Mouse Il 12b Primer (Reverse Sequence: Ccacctgtgagttcttcaaaggc), supplied by Bioneer Corporation, used in various techniques. Bioz Stars score: 90/100, based on 1 PubMed citations. ZERO BIAS - scores, article reviews, protocol conditions and more
    https://www.bioz.com/product/mouse+primer+sequences/il+6+oligonucleotide+primers/pm39799744-57-16-49
    Average 90 stars, based on 1 article reviews
    mouse il-12b primer (reverse sequence: ccacctgtgagttcttcaaaggc) - by Bioz Stars, 2026-10
    90/100 stars
    		  Buy from Supplier

    Image Search Results